Reverse transcription kit independent primer

Reverse transcription kit independent primer

Precio FOB

Obtener el precio más reciente

- Minimum Order

País:

China

N º de Modelo:

Precio FOB:

(Negociable) Obtener el precio más reciente

Lugar de origen:

Precio de pedido mínimo:

Cantidad de pedido mínimo:

Detalle de embalaje:

El tiempo de entrega:

Capacidad de suministro:

Tipo de pago:

Grupo de productos :

Molecular Biology

Contactar ahora

Lablead biotech

China

200 Puntos de confianza

1st Año

Persona de contacto Ying

Contactar ahora

Especificaciones del producto

Descripción del producto

Product:
Reverse transcription kit independent primer (third generation enzyme, independent primer, genome removed) Cat. No.: F***2A Price: $**0 for *0ul***0T Storage conditions: **0°C Product components:

Components	Specification
RTase III Primer Flexible All-in-One Mix	**0 μl
Oligo(dT)0VN (0 μM)	**0 μl
Random hexamers (*0 μM)	**0 μl
dsDNase	2x *0ul
*0× dsDNase Buffer	**0ul
Nuclease-Free Water	2×1 ml

Product Introduction The Primer Flexible is a high-efficiency, low-pollution, high-quality, single-strand cDNA synthesis premix. It contains multiple components required for single-strand cDNA synthesis, such as M-MLV GIII Reverse Transcriptase and its reaction buffer, RNase inhibitors, dNTPs, etc., and the reaction can be started by adding RNA template, primers and water. It is very convenient to operate. Different types of reverse transcription primers can be used flexibly for different experimental designs to meet diverse experimental needs. Oligo(dT)*0VN or Random hexamers or Gene Specific Primers can be selected according to different experimental scenarios. Using this reverse transcription premix, a maximum of *2 kb cDNA can be obtained within *5 minutes. RNA extracted from cells often contains genomic DNA contamination. If it is not removed before reverse transcription, genomic DNA and cDNA will be amplified simultaneously during downstream qPCR reactions (especially when the primers are designed on the same exon), thereby affecting the accuracy of gene expression quantification. This kit uses dsDNase to efficiently remove genomic DNA contamination. dsDNase can specifically digest double-stranded DNA (dsDNA or DNA strands in DNA-RNA hybrid strands) and is heat-sensitive, which can be rapidly and irreversibly inactivated at the reverse transcription temperature. Compared with the traditional method of using DNase I to remove genomic DNA contamination, dsDNase does not require the addition of EDTA for inactivation, which not only saves experimental time, but also reduces the inhibition of reverse transcription reaction. Instructions I. Total RNA 1. Prepare the following reaction system on ice:

Reagents	Amount of Usage
Total RNAa	0ng1ug
dsDNase	1ul
*0× dsDNase Buffer	1ul
Nuclease-Free Water	To *0 ul

a. It is recommended to use RNA extracted by the kit as a template. 2. Gently pipette to mix and spin; 3. Incubate at *7â„ƒ for 2 min to remove genomic DNA contamination; Note: If the genomic DNA contamination in the RNA is serious, the *7â„ƒ incubation time can be appropriately extended to 5 min. 4. Incubate at *5â„ƒ for 2 min to inactivate dsDNase and place on ice. First-strand cDNA synthesis 1.Prepare the following reaction system on ice:

reagents	Usage (experimental group)
Experiment (1) "reaction product	*0ul
RTase III Primer Flexible All-in-One Mix	4 μl
Oligo(dT)0VN (0 μM)	1 μl
Or Random hexamers (*0 μM)	1 μl
Or Gene Speciï¬c Primers (*0 μM)	0.1 μl
Nuclease-Free Water	To *0 μl

2. Mix by gentle pipetting and centrifuge; 3. Incubate at *5â„ƒ for *5 min; Note: If the target RNA does not contain a poly(A) structure, it can be pre-incubated at *5â„ƒ for *0 min. 4. After the reaction, incubate at *5â„ƒ for 5 min to terminate the reaction; 5. Place the obtained cDNA solution on ice for subsequent experiments; or store it immediately at **0â„ƒ. Note: 1. The subsequent experiment is a cloning experiment. If the RNA comes from eukaryotes, only Oligo (dT) VN is needed. Adding Random hexamers will reduce the yield of full-length cDNA; if the RNA comes from prokaryotes, only Random hexamers or Gene Speciï¬c Primers are needed. 2. If the subsequent experiment is qPCR, please add Oligo(dT) VN and Random hexamers at the same time to obtain cDNA with uniform reverse transcription efficiency at different positions of mRNA. II. miRNA Genome removal 1. Prepare the following reaction system on ice:

reagents	Amount of usage
miRNA	0 pg~*0 ng
dsDNase	1ul
*0× dsDNase Buffer	1ul
Nuclease-Free Water	To *0 ul

2. Mix by gentle pipetting and centrifuge; 3. Incubate at *7â„ƒ for 2 min to remove genomic DNA contamination; Note: If the genomic DNA contamination in RNA is serious, the *7â„ƒ incubation time can be appropriately extended to 5 min. 4. Incubate at *5â„ƒ for 2 min to inactivate dsDNase and place on ice. First-strand cDNA synthesis 1. Prepare the following reaction system on ice:

reagents	Usage (experimental group)
Experiment (1)" reaction product	*0ul
RTase III Primer Flexible All-in-One Mix	4 μl
Stem-loop primer(5 μM)b	1 μl
Nuclease-Free Water	To *0 μl

b. The recommended final concentration of stem-loop primers is 0.*5 μM, which can be adjusted within the range of 0.1~0.5 μM. 2. Mix by gentle pipetting and centrifuge; 3. Incubate at *5â„ƒ for *5 min; 4. After the reaction, incubate at *5â„ƒ for 5 min to terminate the reaction; 5. Place the obtained cDNA solution on ice for subsequent experiments; or store immediately at **0â„ƒ. Design of miRNA stem-loop primers and qPCR primers 1. Stem-loop RT primer design: Based on the universal stem-loop structure, only the last 6 bases need to be modified according to different miRNA sequences. The universal stem-loop sequence is: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC; 2. Taking miR***5p as an example, its sequence is CAUACUUCCUUACAUGCCCAUA. Just add the reverse complementary sequence of the 6 bases at the 3' end of miRNA after the universal stem-loop sequence, i.e. GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC "TATGGG"; 3. qPCR upstream primer design: The remaining part of the miRNA sequence after removing the 6 bases at the 3' end is used as the upstream primer. For example, the upstream primer of miR***5p is (note that U is changed to T): CATACTTCCTTACATG. Check the Tm value of the primer. If the Tm value is low, add GC at the 5' end to make the Tm value close to *0â„ƒ. Therefore, the upstream primer of miR***5p can be designed as: GCCGCCATACTTCCTTACATG, *0.3â„ƒ; 4. The downstream primer is universal, and the sequence is GTGCAGGGTCCGAGGT; 5. After the primer is designed, the specificity of the primer needs to be tested through a preliminary test. Generally, a melting curve is required to detect the specificity of the primer; at the same time, it is best to perform electrophoresis on the PCR product to detect whether the product is single (the product length is very short, and more than 3% agarose gel is required). Precautions 1. Before using all reagents, please gently turn them upside down to mix them, try to avoid bubbling, and use them after a short centrifugation; 2. To prevent RNase contamination, please keep the experimental area clean; 3. Wear clean gloves and masks during operation; 4. The consumables such as centrifuge tubes and gun tips used in the experiment must be guaranteed to be RNase-free.

País:	China
N º de Modelo:	-
Precio FOB:	(Negociable) Obtener el precio más reciente
Lugar de origen:	-
Precio de pedido mínimo:	-
Cantidad de pedido mínimo:	-
Detalle de embalaje:	-
El tiempo de entrega:	-
Capacidad de suministro:	-
Tipo de pago:	-
Grupo de productos :	Molecular Biology